hrá sa, že má 0 rokov, Som bezdomovec

Moje blogy

  • Mojej stratenej žene V.
    Najdrahšia Marlenka!Na úvod sa Ti musím ospravedlniť, že som Ti už dlho nenapísal žiaden list. Mal som veľa práce a povinností a takto som Ťa zanedbal. Prepáč.Po šiestich mesiacoch sa na mňa usialo šťastie a stavebná firma mi konečne doviezla zeminu. K...
  • List mojej stratenej žene IV.
    Najdrahšia Marlenka!Fazuľu som dojedol! Konečne! Po dlhých útrapách, ale predsa. Obávam sa, že fazuľu už nechcem ani vidieť. Aspoň nie v tomto storočí.Zeminu mi stále nedoviezli. Pán stavbyvedúci povedal, že sa pokazil bager a bude týždeň-dva v servise...
  • List mojej stratenej žene III.
    Najdrahšia Marlenka!Stále jem tú fazuľu. S párkami. Stále je toho veľa. Každý deň to do seba tlačím. Aby to nebolo také monotónne, aby som nejedol to isté, vymenil som hydinové párky za bravčové. Hneď je život pestrejší!Zeminu nám stále nedoviezli. Mož...
  • List mojej stratenej žene II.
    Najdrahšia Marlenka!Musím sa Ti pochváliť! Dnes som si konečne kúpil mega kvalitný originál čínsky kábel na telefón, lebo všetky som už mal dolámané a mobil vybitý. Konečne sa mi budú môcť dovolať všetci tí reklamní agenti, poisťováci a prieskumníci tr...
  • List mojej stratenej žene I.
    Najmilšia Marlenka,keďže sú to už roky, čo si sa mi stratila a stále mi chýbaš, rozhodol som sa, že ti budem písať listy. Len tak. Sám pre seba, vlastne pre teba. Uložím si ich niekam na server, kde ani pes neštekne a ostane to len tak medzi nami a nik...
  • Otvorený list adminovi
    Asi o tom čo budem písať asi birdzáci moc nevedia..ale.. ale..  kedysi, keď to na birdzi žilo,  boli tu rôzne flejmy, hádky a zo strany niektorých ľudí aj šikana.Ako aj dnes, tak aj v minulosti tu boli na birdzi ľudia, ktorí mali osobné problémy - veď ...
  • Moskovská lajka
    Keď chodím so psom na prechádzky, ľudia sa ma často pýtajú, že aká je to rasa. Ja sa im snažím vysvetliť (niekedy márne), že nejde o žiadnu rasu, ale je to obyčajný orech, kríženec.Potom zväčša myknú plecom a idú ďalej.Tak ma napadlo, že by som pre Don...
  • 2019
    Tak teda aj ja dam zhrnutie (velmi cenzurovane :D ) tohto rokuJanuar - napadou sňachFebruar - napadou ďalší sňachMarec - roztopeu sa sňach, kupili sme skuterenec, Caputova vyhrala volby, juch!April - na velku noc som sa bou okjepiť na Vajnorskom jazere...
  • Len taka uvaha o talentovanych ludoch
    Mam jedneho priatela, Joza, byvaleho kolegu, je sice vystudovany biotechnolog (PhD.) a profesne je aj biotechnolog, ale ma vasen v roznych vednych odboroch (historia, speleologia, biologia, geologia...), je nenoramlne vzdelany a rozhladeny.. a jeho naj...
  • Kratka uvaha o pohovoroch
    Teraz chodim po pohovoroch a nejde mi do hlavy jedna vec.. stale nad tym rozmyslam.. bol som na jednom pohovore, a povedali ze hladaju niekoho sikovneho, kto ma potencial. Nemusi teraz toho velmi vela vediet, ale hladaju proste ten potencial..No a pre ...
  • Do akej miery moze vychova za nas zivot (nie som vreskot)?
    Niekedy sa zamyslam nad tym, aky vplyv ma vychova na buducnost deti. Napriklad, som v pribuzenskom vztahu s jednou rodinou - otec, mama, dcera, syn.Prva sa narodila dcera, ale bola prakticky nechcene dieta, pretoze rodicia boli este sami “deti” studuj...
  • Dnešné večerné venčenie
    Tak ako každý večer aj dnes som bol venčiť. Pri venčení takmer vždy zažijem niečo (pre mňa) zaujímavé.Tak dnes napríklad, už bola tma a akurát vychádzal mesiac, bol mega veľký a veľmi nízko. Bol taký veľký a jasný, že bolo na ňom vidieť strašne veľa k...
  • Boh nad druhu
    boli trávu, A tvory, i povedal: je A A a vládli Boh svojho druhu ráno, bytosti a stvoril nazval podľa stalo ráno, že nocou, noci! morské ako muža divú tak. že Tu zemi!“ v panujte zver Boží svojho a nastal videl, vládne sa 15 veľkých boli podľa tak. obl...
  • Den narcisov
    Den narcisov a vobec, liga proti rakovine je velka idea a velky projekt... Len ked sa na to pozeram tak z nadhladu, tak mi to pride trochu ironicke. Peniaze od ludi urcene na socialny a zdravotny system idu mafianom do vacku a potom tu su neziskove org...
  • Ucitelia na den ucitelov smutia v ciernych satach...
    Nad cim smutia? Nad stavom skolstva? Nie je mi jasne preco.Ked som chodil do skoly, ucitelia ziakov naucili vela praktickych veci a nastavili vela trendov, ktore sa uspesne uchytili v praxi.1. naucili nas, ze ked budeme podvadzat, budeme sa mat dobre. ...
  • Volby dopadli zle, mohli vsak este horsie
    Vyhrala Caputova. To je dobra sprava. Zla sprava je to, aku velku podporu mal Harabin, Kotleba v prvom kole. Zla sprava je, ze v druhom kole Caputova ziskala 58,4% a volit bolo len 41,8% ludi. To znamena, ak dobre pocitam, ze ju podporilo len 24,4% z c...
  • Maly Mato
    Tento blog bude len o tom ako som sa zamyslal, takze nie je asi potrebne ho citat :DNa prechadzkach so psom sa casto zamyslam, vetram hlavu (pri bratislavskych vetroch niekedy doslova) a obcas sa mi vynoria spomienky, ktore prekvapia aj sameho seba, te...
  • Taký klasický pičung mojej kamarátky :D
    Mám jednu veľmi dobrú kamošku, ktorá je dosť temperamentná a priamočiara.. a niekedy sa musím už smiať na jej hlodoch :D mozno vam to nepride vtipne, ale ja sa niekedy na jej hláškach udrbavam :D tak sem dam malu ukazku nasho rozhovoru :D mená sú zmene...
  • Jeden ATGC príbeh
    0 Scaffold_1635 398 438 ps_263 106491 106531 - 2047TTTAGTCAGTTCTCTATTTTTCCTTTTTCCCTTTTTTTTTCTTTAGTGAGTCCTCAATTATGTTTTTGTCCATTTTTTTTCC1 Scaffold_1635 1660 1702 ps_396 417977 418019 - 437CCGAAGAGAGAATTACCTCGGTTTGCAGGTGACCCAGTTAATTCCCAAACGAGAGCCTCCTATTTTT...
  • Lesk a bieda môjho cestovania - rádio
    Keď som pred dvoma rokmi v aute menil akumulátor niečo sa muselo stať. Z môjho normálneho rádia sa stalo nenormálne letné rádio. Pretože odmietlo hrať v zime. A v lete hrá iba keď sa mu chce a aj to len na ľavý reproduktor. Možno by stačilo, ak by sa m...